Ethics assertion
4- to five-week-old K18-hACE2 C57BL/6 mice (human ACE2 gene knock-in C57BL/6 mice) by Cyagen Biosciences (animal license quantity SCXK (Su) 2022-0016). BALB/c mice and seven- to eight-week-old golden hamsters had been bought from Very important River (animal license numbers SCXK (Jing) 2021-0006 and SCXK (Jing) 2021-0011). All animals had been bred in particular pathogen-fee barrier services (laboratory license quantity SYXK (Lu) 2020-0019). The laboratory animals had been cared for and used following the ‘3 Rs’ precept and animal welfare pointers. The animal experiment course of and animal-related care and welfare had been reviewed and accredited by the Animal Experiment Ethics Committee of Shandong WeigaoLitong Organic Merchandise (approval quantity LACUC-RD3-2022-006).
Cell traces
HEK-293T and 16HBE cells had been cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; HyClone, GE Healthcare), 10% 100 U ml−1 penicillin and 100 mg ml−1 streptomycin. JASWII dendritic cells had been cultured in MEM Alpha (Thermo Fisher Scientific) supplemented with 20% FBS and 5 ng ml−1 murine granulocyte–macrophage colony-stimulating issue (HY-P7361, MCE). RAW264.7 cells had been cultured in minimal Eagle’s medium (MEM; Thermo Fisher Scientific) supplemented with 10% FBS. THP-1 cells had been cultured in RPMI 1640 (Thermo Fisher Scientific) supplemented with 10% FBS and 0.05 mM β-mercaptoethanol (M917637, Macklin). All cells had been bought from ATCC and maintained at 37 °C with 5% CO2.
Virus
The novel coronavirus H pressure (Omicron BA.5) was remoted from COVID-19 sufferers in December 2022. The entire genome sequence was uploaded to NCBI GenBank (OQ179919.1). The novel coronavirus KMS-2 pressure (Wuhan) was remoted from COVID-19 sufferers on the Hospital for Infectious Illnesses in Yunnan Province in February 2020.
Animal experimental design
C57BL/6-ACE2 (BALB/c or golden hamster) mice had been randomly divided into 5 teams (Supplementary Fig. 7).
In group A (immune experimental group, n = 35), C57BL/6-hACE2 mice had been divided into 4 teams: management, VLS, mRNA and peptide. The VLS contained 20 μg of mRNA and 10 μg of protein; the mice within the mRNA group had been immunized with 20 μg of mRNA, and the mice within the peptide group had been immunized with 10 μg of protein. All of the mice underwent booster immunization on the twenty first day after major immunization. At 24, 48 and 72 h after major immunization, tissues from the immune web site had been obtained for immunofluorescence detection for qRT–PCR measurement of cytokine expression. Furthermore, B, CD4+ T and CD8+ T cells had been sorted from lymph nodes at 3, 7 and 14 days after major immunization and 28 days after booster immunization for transcriptome sequencing.
In group B (immune experimental group, n = 36), C57BL/6-hACE2 mice had been divided into three teams: the management, VLS and mRNA teams. The mRNA used for the VLS and mRNA vaccines to discover the tissue web site of mRNA molecules with the supply system. The guts, liver, spleen, kidneys, lungs, mind and lymph nodes had been collected at 1, 3, 5 and seven days after i.m. injection for tissue immunofluorescence detection.
In group C (immune experimental group, n = 72), BALB/c mice had been divided into 12 teams: N1–N12. N1–N4 had been the mRNA vaccine teams, N5–N8 had been the VLS vaccine teams and N9–N12 had been the peptide vaccine teams. N1–N4 contained 5, 10, 20 and 40 μg mRNA, respectively. N5–N8 contained 5 μg mRNA and 5 μg peptide, 10 μg mRNA and 5 μg peptide, 10 μg mRNA and 10 μg peptide, and 20 μg mRNA and 10 μg peptide, respectively. N9–N12 contained 5 μg, 10 μg, 20 μg and 30 μg of peptide, respectively. All of the mice underwent booster immunization on the twenty first day after major immunization. Blood samples had been collected from the tail vein on days 35, 49, 120, 180 and 240 after immunization for antibody detection. At 28 days after booster immunization, blood was collected for neutralizing antibody and binding antibody testing, and the spleen was subjected to lymphocyte separation and ELISpot assays. On the identical time, the immune titre of the SARS-CoV-2 vaccine was in contrast.
In group D (immunoprotective experimental group; C57BL/6-hACE2, n = 75; golden hamster, n = 40), at 28 days after booster immunization, the mice within the management, VLS, mRNA and peptide teams had been challenged with SARS-CoV-2 Omicron BA.5 (104.5 50% cell tradition infectious dose (CCID50)), SARS-CoV-2 wild-type (104 CCID50) or SARS-CoV-2 Omicron XBB.1 (104.5 CCID50) through the intranasal route. The guts, liver, spleen, kidneys, lungs, trachea, mind, spinal wire, lymph nodes and intercourse organs had been collected at 3, 5 and seven days after viral an infection for viral load quantification. In the meantime, B, CD4+ T and CD8+ T cells had been sorted from C57BL/6-hACE2 mouse lymph nodes at 3 days after problem for transcriptome sequencing.
In group E (transfusion experiment, n = 27), DCs had been handled with LNPs-peptide, LNPs-mRNA and VLSs for 12 h. The in vitro-treated DCs (3 × 105 cells per mouse) had been transfused into mice by the tail vein. The spleen and inguinal lymph nodes had been obtained at 3 and 5 days after adoptive switch for circulation cytometry and qRT‒PCR. Antibody titres had been measured 21 days after transfusion. The above animal problem experiments had been commissioned by Wuhan Institute of Organic Merchandise.
Synthesis and formulation of the LNP supply system
Based on the molecular weights of ((2-(2-hydroxyethoxyl)ethyl)azanddiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate), 1,2-dioleoyl-3-trimethylammonium propane, 1,2-dierucoyl-phosphatidylcholine and methoxypoly(ethylene glycol)-N-tetradecyltetradecanamide-1-2k, these had been dissolved in absolute ethanol (Grade of assured reagent) to molecular concentrations of 20%, 10%, 20% and 10%, respectively. All 4 parts had been blended at a molar ratio of 30.68:6.84:15.2:1 in ethanol to organize the LNP supply system. The mRNA was diluted in keeping with the requested ratio in buffer of 20 mM sodium acetate, 2.5 mM KCl and 0.1% trehalose. The LNP–mRNA was ready with NanoAssemblr Ignite+ LNPs (Precision Nanosystems) by mixing clean LNPs with mRNA at a weight ratio of 1:3. The lipid particles had been additional characterised by Zetasizer Extremely spectrometry.
Synthesis of SARS-CoV-2 S1 mRNA
The S1 sequence of SARS-CoV-2 was amplified and inserted into the PVAX vector by PCR expertise. The 5′-untranslated area (UTR) of yellow fever virus was amplified and inserted earlier than the Kozak sequence and the three′-UTR of the human mitochondrial ribosome was amplified and inserted after the S1 sequence because the 5′-UTR and three′-UTR of the S1 sequence. The constructed plasmid was linearized with BamHI (catalogue quantity R0136V, NEB) at 37 °C for 3 h for the in vitro transcription response. N1mψ-modified S1 mRNA was synthesized by an in vitro transcription response (HiScribe T7 ARCA mRNA Equipment, catalogue quantity E2060S, NEB). The response combination was handled with DNase I and purified utilizing lithium chloride precipitation.
Preparation of the VLS vaccine
The VLS vaccine was ready by including LNP–mRNA and peptide to the buffer (0.1% trehalose and three.5% glucose) and mixing at room temperature for 30 min at 30 r.p.m. earlier than rotating the combination at 10 r.p.m. at 4 °C in a single day. The VLS vaccine was additional characterised by Zetasizer Extremely spectrometry.
LNP mRNA- and VLS-transfected cells
Then, 0.5, 1, 2, 5 and 10 μg of mRNA was transfected into 293T cells with the LNP supply system, and western blot detection was carried out at 24 h after transfection. In the meantime, the mRNA and VLSs had been transfected into 16HBE, JASWII DCs, THP-1 cells and RAW264.7 cells for Western blot evaluation and qRT‒PCR measurement at 24 h.
Co-immunoprecipitation
Anti-S1 and anti-N antibodies had been added to the LNP-encapsulated mRNA and VLS vaccine (the VLS vaccines had been loaded with BA.1 S1 protein or N protein). Then, 50 μl of magnetic beads (BeaverBeads Protein A Matrix Antibody Purification Equipment, catalogue quantity 20102, Suzhou) had been added and incubated for 30 min at room temperature at 30 r.p.m. Subsequent, the samples with magnetic beads had been adsorbed at room temperature for two–3 min on the magnetic pole, and the supernatant was used for mRNA and protein content material measurement. Then, washing buffer was used to scrub the beads, and elution buffer was added for elution and measurement of mRNA by qRT‒PCR and protein content material by ELISA.
qRT–PCR
The quantity of mRNA within the VLS and mRNA vaccines was measured by qRT‒PCR. Based mostly on the rules, the binding web site designed for the primer was situated within the SARS-CoV-2 S1 gene area, and a part of the S1 gene was constructed within the pUC57 plasmid. In vitro-transcribed mRNA was used as a typical pattern. The primers had been F: TGGATCTGGAGGGAAAGCAGGGCAACT and R: CCGATTGGCAGATCCACCAGAGGTTC, and the TaqMan probe (Sangon Biotech) had the sequence 5′-6FAM-ATGGCTACTTCAAGATCTATAGCAAGC-TAMRA-3′.
The viral masses within the tissues had been decided by qPCR with absolute quantification. Based mostly on World Well being Group pointers, the binding web site designed for the primer was situated within the SARS-CoV-2 N gene area, and the N gene was constructed on the pUC57 plasmid. The primers had been F: GAATGGCTGGCAATGGCGGTGATGCT and R: TTGTTGGCCTTTACCAGACATTTTGCT, and the TaqMan probe (Sangon Biotech) had the sequence 5′-6FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Viral genomic RNA was extracted from tissues utilizing RNAiso Plus (T9108, Takara), and the reactions had been carried out utilizing a One Step PrimeScript RT‒PCR Equipment (Excellent Actual Time) (TaKaRa, code RR064A).
For the relative expression of cytokines in tissues and cells, complete RNA was extracted with RNAiso Plus (T9108, Takara). Gene expression was expressed because the fold change (2−∆∆Ct) relative to the degrees in samples from LNP-injected mice or virus-uninfected cells, which had been used for calibration. The reactions had been carried out through the use of a One-Step SYBR PrimeScript PLUS RT–PCR Equipment (TakaRa, code RR096A). The particular primers used are listed in Prolonged Information Tables 4 and 5.
Immunofluorescence and confocal microscopy
Muscle tissues had been collected and instantly frozen in liquid nitrogen. The tissue sections had been embedded in OCT (Tissue-Tek OCT Compound 4583, Sakura) and sliced on a cryostat to a thickness of 5 µm (CM1850, Leica). Tissue sections had been fastened and blocked with 5% BSA. For detection of the viral antigen, the sections had been sequentially incubated with a major mouse anti-SARS-CoV-2 S antibody (Sino Organic, catalogue quantity 40150-V08B1) and an Alexa Fluor 647-conjugated goat anti-mouse IgG secondary antibody (Invitrogen). DCs had been detected utilizing an anti-CD11c antibody (Abcam, catalogue quantity ab33483-N418), and macrophages had been detected utilizing an anti-F4/80 antibody (Zhengneng, catalogue quantity 263101-31B1), an Alexa Fluor 488-conjugated goat anti-rabbit IgG secondary antibody and a 647-conjugated goat anti-mouse IgG secondary antibody (Invitrogen). All cell nuclei had been detected utilizing 4,6-diamidino-2-phenylindole and analysed utilizing a confocal microscope (TCS SP2, Leica).
Virus titration
The virus titre was decided with a plaque assay in accordance with customary protocols, as described beforehand28. In short, the virus was subjected to gradient dilution and added to six-well plates. Carboxymethylcellulose was used because the matrix in a liquid overlay, crystal violet was used because the stain to reinforce plaque visualization, and the cells had been cultured at 37 °C with 5% CO2 for 7 days.
Neutralization assay
Briefly, serum was inactivated for 30 min at 56 °C, constantly diluted from 1:4 and blended with virus at a titre of 100 instances the CCID50/100 μl and incubated at 37 °C for two h. The combination was added to a six-well plate and used carboxymethylcelluloseas the matrix, and crystal violet was used because the stain to reinforce plaque visualization after tradition at 37 °C with 5% CO2. In the meantime, the serum neutralization titres of pseudoviruses had been measured, and the 50% inhibitory dilution (EC50) was outlined because the serum dilution at which the relative mild models had been decreased by 50% in contrast with these of the virus management wells (virus + cells) after subtraction of the background relative mild models within the management teams with cells solely. In short, pseudovirus (Acro, catalogue quantity PSSO-HLC016) was incubated with serial dilutions of the check samples constantly diluted from 1:64 in duplicate for 1 h at 37 °C, along with the virus management and cell management wells. Then, 293T-ACE2 cells had been added to every nicely. Following 48 h of incubation in a 5% CO2 surroundings at 37 °C, the luminescence was measured.
IFNγ-specific and IL-4-specific ELISpot assay
For the ELISpot assay, mouse IFNγ and IL-4 ELISpot kits (Mabtech) had been used in keeping with the producer’s protocol. Briefly, a plate was conditioned and seeded with splenic lymphocytes previous to the addition of three μg of stimulant (XBB Spike RBD Protein, catalogue quantity 40592-V08H144, Sino Organic; B.1.1.529 Spike RBD Protein, catalogue quantity SPD-C522e, Acro; BA.4/BA.5 Spike RBD Protein, catalogue quantity SPD-C522R, Acro; BA.2.12.1 Spike RBD Protein, catalogue quantity SPD-C522q, Acro; BQ.1.1 Spike RBD Protein, catalogue quantity SPD-C5240, Acro; BA.2.75.2 Spike RBD Protein, catalogue quantity SPD-C522z, Acro). Then, the cells had been added and incubated at 37 °C for 30 h. Subsequent, the cells and medium had been eliminated, and the plate was developed. The colored spots had been counted utilizing an ELISpot reader (Mabtech).
Isolation of B, CD4+ T and CD8a+ T cells from mouse lymph nodes
Lymph nodes had been remoted underneath sterile circumstances and gently floor, and lymphocytes had been separated right into a suspension.
B cells had been enriched with MajoSort Mouse CD19 Nanobeads (catalogue quantity SPD-C522R, Acro 480002, BioLegend), CD4+ T cells had been enriched with the EasySep Mouse CD4+ T-cell isolation package (catalogue quantity SPD-C522R, Acro 19852A, Stemcell), and CD8+ T cells had been enriched with the EasySep Mouse CD8a+ choice package (catalogue quantity SPD-C522R, Acro 18953, Stemcell).
Transcriptome evaluation of B, CD4+ T and CD8a+ T cells
The B, CD4+ T and CD8a+ T cells had been sorted by lymph nodes. Whole RNA was extracted utilizing TRIzol (catalogue quantity DP421, Tiangen). RNA amount and integrity had been evaluated utilizing a NanoDrop system and a Bioanalyzer, and the samples had been ready in keeping with Illumina’s directions and sequenced (Gene Denovo Biotechnology). Genes with 2-fold or larger adjustments in expression at P < 0.05 within the Kyoto Encyclopedia of Genes and Genomes analyses had been chosen and grouped into practical classes. All transcriptome sequencing outcomes had been uploaded to GSA; the assigned accession variety of the submission was CRA010542.
ELISA
The S1 antigen was quantified utilizing a SARS-CoV-2 Spike Protein ELISA Equipment (Acro, catalogue quantity RAS-A039), and the nucleoprotein was quantified utilizing a SARS-CoV-2 (2019-nCoV) Nucleoprotein ELISA Equipment (Jiya Biotechnology,). S1-RBD IgG assays had been carried out utilizing SARS-CoV-2 RBD (Wild-Kind) Antibody (IgG) Detection Kits (Vazyme, catalogue quantity DD3201-01), SARS-CoV-2 RBD (Omicron BA.4/5) Antibody (IgG) Detection Kits (Vazyme, catalogue quantity DD3214-01, China) and Mouse Anti-2019-nCoV (S) IgA Elisa Kits (FineTest, catalogue quantity 1906).
The S1 antibody assays had been carried out utilizing a Mouse Anti-SARS-CoV-2 (B.1.1.529) Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T061), Mouse Anti-SARS-CoV-2 Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T045), Mouse Anti-SARS-CoV-2 (B.1.351) Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T084), Mouse Anti-SARS-CoV-2 (B.1.617.2) Antibody IgG Titer Serologic Assay Equipment (Spike S1) (Acro, catalogue quantity RAS-T086). The antibody serum samples that yielded optical density values a minimum of 2.1-fold larger than that of the unfavorable management had been thought of optimistic. The endpoint titre was outlined as the very best serum dilution that yielded a optimistic optical density worth. The geometric imply titre was calculated because the geometric imply of the endpoint titres of the optimistic serum samples in every group.
Western blotting
Proteins had been separated by 12% SDS–PAGE and transferred to polyvinylidene difluoride membranes. The membranes had been blocked with 5% bovine serum albumin–Tris-buffered saline with Tween-20 (Sigma-Aldrich) and incubated with an anti-SARS-CoV-2 S1 antibody (MHC0102, Yunnan Lepeng Expertise), anti-ACE2 antibody (Abcam, catalogue quantity ab15348), and anti-DC-SIGN antibody (Santa Cruz Biotechnology, catalogue quantity sc-74589) for two h; washed thrice and incubated with HRP-conjugated goat anti-mouse IgG (H + L) (Sigma) for 1 h. Lastly, the polyvinylidene difluoride membranes had been washed thrice and lined with ECL ultrasensitive chemiluminescence reagent (NCM Biotech, catalogue quantity P10100) and positioned in a Bio-Rad gel imager for publicity and color improvement.
Silver staining with SDS‒PAGE
The ready SDS–PAGE gel was silver-stained with a package (Quick Silver Stain Equipment, catalogue quantity P0017S, Beyotime). Silver staining of the SDS‒PAGE gels was carried out in ten steps: fixation, washing with 30% ethanol, washing with water, sensitization, washing with water, silver staining, washing with water, color improvement, termination and washing with water.
Move cytometry evaluation
Lymph nodes and spleens had been collected on days 3 and seven after major and booster immunization with the vaccine, and remoted lymphocyte. The flow-labelled antibodies used to detect the floor markers of DC activation had been PE/Cy5-CD45 (catalogue quantity MA5-38732, Thermo Fisher), PE/Cy7-CD11c (catalogue quantity A15849, Thermo Fisher), FITC-CD80 (catalogue quantity A14722, Thermo Fisher), APC-CD83 (catalogue quantity ab234119, Abcam), and PE-CD86 (catalogue quantity 12-0862-82, Thermo Fisher). The flow-labelled antibodies used to detect particular T-cell floor markers had been BV421-CD44 (catalogue quantity 103019, BioLegend), APC-CD25 (catalogue quantity 102011, BioLegend), PE/Cy5-CD3 (catalogue quantity 100205, BioLegend), FITC-CD4 (catalogue quantity 100405, BioLegend), APC/Cy7-CD8 (catalogue quantity 100713, BioLegend) and PE-Tetramer (Helixgen COVID-19 MHC-I Tetramer). The flow-labelled antibodies used to detect activated B-cell floor markers had been FITC-CD19 (catalogue quantity 115505, BioLegend), PerCp/Cy5.5-GL7 (catalogue quantity 144609, BioLegend) and PE-S1 (Expedeon, catalogue quantity 336-005). The cells had been stained for 30 min at 4 °C and washed twice previous to circulation cytometric evaluation (LSR Fortessa, BD).
Luminex assays
The Bio-Plex Mouse 23-Plex Panel assay (catalogue quantity M60009RDPD) was carried out in keeping with the producer’s directions. Briefly, a typical curve starting from 1.6 to 10,000 pg ml−1 was generated by serial dilution of the reconstituted customary. The filter plates had been blocked by pipetting 200 µl of assay buffer into every nicely. After 10 min, the assay buffer was discarded by vacuum aspiration, and 25 µl of assay diluent was added to the wells designated for the samples, RPMI 1640 with GlutaMAX (Gibco) was added to the wells for the requirements. Then, customary or pattern was added to the suitable wells, and 25 µl of antibody-coated fluorescent beads was added. Biotinylated secondary and streptavidin–phycoerythrin-labelled antibodies had been subsequently added to the plate by alternating incubation and washing steps. Then, 100 µl of sheath fluid was added to the wells, and skim instantly with the Bio-Plex array reader at excessive and low RP1 targets utilizing a five-parameter logistic regression curve.
Statistical evaluation and reproducibility
For western blot and electron microscopy, immunofluorescence assays had been repeated a minimum of twice; for ELISA, quantitative evaluation was repeated a minimum of thrice. All the info are expressed as imply values with s.e.m. Vital variations between teams had been analysed by GraphPad Prism. Statistical significance was set to P < 0.05.
Reporting abstract
Additional info on analysis design is offered within the Nature Portfolio Reporting Abstract linked to this text.
